Class
FragmentStoreMulti-container to store contigs, reads, multiple read alignments and genome annotations.
| Defined in | <seqan/store.h> |
|---|---|
| Signature |
template <[typename TSpec[, typename TConfig]]>
class FragmentStore;
|
Template Parameters
TSpec |
The specialializing type. Default: void. |
|---|---|
TConfig |
The configuration struct. Default: FragmentStoreConfig<TSpec>. |
Member Function Overview
-
void clearReads(store);Removes all reds from a FragmentStore.
Interface Function Overview
-
TSize appendAlignedRead(store, readId, contigId, beginPos, endPos[, pairMatchId]);Appends an aligned read entyr to a fragment store. -
TSize appendMatePair(store, readSeq1, readSeq2[, name1, name2]);Appends the two reads of a mate pair to a FragmentStore. -
TSize appendRead(store, read[, matePairId]);, TSize appendRead(store, read, name[, matePairId]);Append a read to a FragmentStore. -
void calculateInsertSizes(insertSizes, store);Calcualtes a string wtih insert sizes for each pair match. -
void calculateMateIndices(mateIndices, store);Calculates a string that maps the readId of a read to the index of its mate in the alignedReadStore. -
void clearContigs(store);REvmoes all contigs from a FragmentStore. -
TSize compactAlignedReads(store);Remove invalid aligned reads and rename the alignId's sequentially beginning with 0. -
TSize compactPairMatchIds(store);Renames pairMatchId sequentially beginning with 0. -
void convertMatchesToGlobalAlignment(store, score, shrinkMatches);Converts all matches to a multiple global alignment in gap-space. -
void convertPairWiseToGlobalAlignment(store, pairwiseContigGaps);Converts pairwise alignments to a multiple global alignment. -
void getClrRange(store, alignEl, begClr, endClr);Get the "clear" range of a read alignment. -
int getMateNo(store, readId);Returns the mate number for a read given a readId. -
TRead getRead(store, id);Returns the read with the given readId. -
bool loadContig(store, contigId);Manually load a contig sequence. -
bool loadContigs(store, fileName[, loadSeqs]);, bool loadContigs(store, fileNameList[, loadSeqs]);Load contigs into a FragmentStore. -
bool loadReads(store, fileName);, bool loadReads(store, fileNameL, fileNameR);Loads reads into FragmentStore -
bool lockContig(store, contigId);Locks a contig sequence from being removed. -
bool lockContigs(store);Locks all contig sequences from being remove. -
int read(file, store, tag);Read the contents of a FragmentStore from a file. -
void readRecords(store, bamFileIn[, importFlags]);, void readRecords(store, gffFileIn);, void readRecords(store, ucscFileIn);Read all records from a file. -
bool unlockContig(store, contigId);Removes a previous contig lock and clears the sequence if no further lock exists. -
bool unlockAndFreeContigs(store);Unlocks all contig sequences and clears sequences without lock. -
bool unlockContig(store, contigId);Removes a previous contig lock. -
bool unlockContigs(store);Unlocks all contig sequences. -
int write(file, store, tag);Write the contents of a FragmentStore to a file. -
bool writeContigs(file, store, tag);Write contigs from FragmentStore into a StreamConcept. -
void writeRecords(bamFileOut, store);, void writeRecords(gffFileOut, store);, void writeRecords(ucscFileIn, store);Write all records to a file.
Member Typedef Overview
-
typedef (..) TFragmentStore::TAlignedReadStore;Type of the alignedReadStore member. -
typedef (..) TFragmentStore::TAlignedReadTagStore;Type of the alignedReadTagStore member. -
typedef (..) TFragmentStore::TAlignQualityStore;Type of the alignQualityStore member. -
typedef (..) TFragmentStore::TAnnotationKeyStore;Type of the annotationKeyStore member. -
typedef (..) TFragmentStore::TAnnotationNameStore;Type of the annotationNameStore member. -
typedef (..) TFragmentStore::TAnnotationStore;Type of the annotationStore member. -
typedef (..) TFragmentStore::TAnnotationTypeStore;Type of the annotationTypeStore member. -
typedef (..) TFragmentStore::TContigFileStore;Type of the contigFileStore member. -
typedef (..) TFragmentStore::TContigNameStore;Type of the contigNameStore member. -
typedef (..) TFragmentStore::TContigStore;Type of the contigStore member. -
typedef (..) TFragmentStore::TLibraryNameStore;Type of the libraryNameStore member. -
typedef (..) TFragmentStore::TMatePairNameStore;Type of the matePairNameStore member. -
typedef (..) TFragmentStore::TMatePairStore;Type of the matePairStore member. -
typedef (..) TFragmentStore::TReadNameStore;Type of the readNameStore member. -
typedef (..) TFragmentStore::TReadSeqStore;Type of the readSeqStore member. -
typedef (..) TFragmentStore::TReadStore;Type of the readStore member.
Member Variable Overview
-
FragmentStore::TAlignedReadStore FragmentStore::alignedReadStoreString that stores (alignId, readId, contigId, pairMatchId, beginPos, endPos, gapAnchors). -
FragmentStore::TAlignedReadTagStore FragmentStore::alignedReadTagStoreStringSet that maps from alignId to alignTag. -
FragmentStore::TAlignQualityStore FragmentStore::alignQualityStoreString that maps from alignId to (pairScore, score, errors). -
FragmentStore::TAnnotationKeyStore FragmentStore::annotationKeyStore -
FragmentStore::TAnnotationNameStore FragmentStore::annotationNameStoreStringSet that maps from annoId to annoName; -
FragmentStore::TAnnotationStore FragmentStore::annotationStoreString that maps from annoId to (contigId, typeId, beginPos, endPos, parentId, lastChildId, nextSiblingId, values). -
FragmentStore::TAnnotationTypeStore FragmentStore::annotationTypeStoreStringSet that maps from typeId to the type name of an annotation, e.g. "gene" or "exon". typeId is a member of the AnnotationStoreElement. -
FragmentStore::TContigFileStore FragmentStore::contigFileStoreString that maps from contigId to (contigSeq, contigGaps, contigFileId). -
FragmentStore::TContigNameStore FragmentStore::contigNameStoreStringSet that maps from contigId to contigName. -
FragmentStore::TContigStore FragmentStore::contigStoreString that maps from contigId to (contigSeq, contigGaps, contigFileId). -
FragmentStore::TLibraryNameStore FragmentStore::libraryNameStoreA StringSet that maps from libId to libName. -
FragmentStore::TLibraryStore FragmentStore::libraryStoreString that maps from libId to (mean, std). -
FragmentStore::TContigNameStore FragmentStore::matePairNameStoreStringSet that maps from contigId to matePairName. -
FragmentStore::TMatePairStore FragmentStore::matePairStoreString that maps from matePairId to (readId[2], libId). -
FragmentStore::TReadNameStore FragmentStore::readNameStoreStringSet that maps from readId to readName. -
FragmentStore::TReadSeqStore FragmentStore::readSeqStoreStringSet that maps from readId to readSeq. -
FragmentStore::TReadStore FragmentStore::readStoreA String that maps from readId to matePairId.
Detailed Description
The FragmentStore is a data structure specifically designed for read mapping, genome assembly or gene annotation. These tasks typically require lots of data structures that are related to each other like: reads, mate-pairs, reference genome; pairwise alignments; genome annotation.
The FragmentStore subsumes all these data structures in an easy to use interface. It represents a multiple alignment of millions of reads or mate-pairs against a reference genome consisting of multiple contigs. Additionally, regions of the reference genome can be annotated with features like 'gene', 'mRNA', 'exon', 'intro' or custom features. The FragmentStore supports I/O functions to read/write a read alignment in Sam or Amos format and to read/write annotations in Gff/Gtf format.
The FragmentStore can be compared with a database where each table (called "store") is implemented as a String member of the FragmentStore class. The rows of each table (implemented as structs) are referred by their ids which are their positions in the string and not stored explicitly. The only exception is the alignedReadStore whose elements of type AlignedReadStoreElement contain an id-member as they may be rearranged in arbitrary order, e.g. by increasing genomic positions or by readId. Many stores have an associated name store to store element names. Each name store is a StringSet that stores the element name at the position of its id. All stores are present in the FragmentStore and empty if unused. The concrete types, e.g. the position types or read/contig alphabet, can be easily changed by defining a custom config struct which is a template parameter of the FragmentStore class.
Examples
Load read alignments and a reference genome and display the multiple alignment in a genomic range:
#include <iostream>
#include <seqan/store.h>
using namespace seqan2;
int main()
{
// instantiate emtpy FragmentStore and set file paths
FragmentStore<> store;
std::string pathGenome = getAbsolutePath("/demos/tutorial/store/ex1.fa");
std::string pathSAM = getAbsolutePath("/demos/tutorial/store/ex1.sam");
// load example genome and example reads and alignments
loadContigs(store, pathGenome.c_str());
BamFileIn bamFile(pathSAM.c_str());
readRecords(store, bamFile);
// compute staircase read layout and print from position 30..129
AlignedReadLayout layout;
layoutAlignment(layout, store);
printAlignment(std::cout, layout, store, 1, 30, 130, 0, 36);
return 0;
}
ATTTAAGAAATTACAAAATATAGTTGAAAGCTCTAACAATAGACTAAACCAAGCAGAAGAAAGAGGTTCAGAACTTGAAGACAAGTCTCTTATGAATTAA
ATTTAA AATTACAAAATATAGTTGAAAGCTCTAACAATAGA AACCAAGCAGAAGAAAGAGGTTCAGAACTTGAAGA AGTCTCTTATGAATTAA
ATTTA GAAATTACAAAATATAGTTGAAAGCTCTAACAATA ACTAAACCAAGCAGAAGAAAGAGGTTCAGAACTTG AGACAAGTCTCTTATGAATTAA
attta GAAATTACAAAATATAGTTGAAAGCTCTAACAATAG AACCAAGCAGAAGAAAGAGGCTCAGAACTTGAAGA AGTCTCTTATGAATTAA
ATTTAA ATTACAAAATATAGTTGAAAGATCTAACAATAGAC CCAAGCAGAAGAAAGAGGTTCAGAACTTGAAGACAA TTATGAATTAA
ATTTAAGAA TTACAAAATATAGTTGAAAGCTCTAACAATAGACT AAGCAGAAGAAAGAGGTTCAGAACTTGAAGACAAG TATGAATTAA
ATTTAAGAAA ACAAAATATAGTTGAAAGCTCTAACAATAGACTAA GCAGAAGAAAGAGGTTCAGAACTTGAAGACAAGTC ATGAATTAA
ATTTAAGAAA ACAAAATATAGTTGAAAGCTCTAACAATAGACTAA CAGAAGAAAGAGGTTCAGAACTTGAAGACAAGTCT TGAATTAA
ATTTAAGAAA ACAAAATATAGTTGAAAGCTCTAACAATAGACTAA CAGAAGAAAGAGGTTCANANNNTGANGACAAGTCT TGAATTAA
ATTTAAGAAATT CAAAATATAGTTGAAAGCTCTAACAATAGACTAAA GAAGAAAGAGGTTCAGAACTTGAAGACAAGTCTCT GAATTAA
ATTTAAGAAAT AAAATATAGTTGAAAGCTCTAACAATAGACTAAAC AAGAAAGAGGTTCAGAACTTGAAGACAAGTCTCGT GAATTAA
ATTTAAGAAAT AAAATATAGTTGAAAGCTCTAACAATAGACTAAAC AAGAAAGAGGTTCAGAACTTGAAGACAAGTCTCTT AATTAA
ATTTAAGAAAT AAATATAGTTGAAAGCTCTAACAATAGACTAAACC GAAAGAGGTTCAGAACTTGAAGACAAGTCTCTTATG
ATTTAAGAAATT AAATATAGTTGAAAGCTCTAACAATAGACTAAACC AAGAGGTTCAGAACTTGAAGACAAGTCTCTTATGA
ATTTAAGAAATT AATATAGTTGAAAGCTCTAACAATAGACTAAACCAA AAGAGGTTCAGAACTTGAAGACAAGTCTCTTATGA
ATTTAAGAAATTACA ATATAGTTGAAAGCTCTAACAATAGACTAAACCAA GAGGTTCAGAACTTGAAGACAAGTCTCTTATGAAT
ATTTAAGAAATTACAA ATAGTTGAAAGCTCTAACAATAGACTAAACCAAGC GAGGTTCAGAACTTGAAGACAAGTCTCTTATGAAT
ATTTAAGAAATTACAAAATA AGTTGAAAGCTCTAACAATAGACTAAACCAAGCAG AGGTTCAGAACTTGAAGACAAGTCTCTTATGAATT
ATTTAAGAAATTACAAAATAT TTGAAAGCTCTAACAATAGACTAAACCAAGCAGAA GGTTCAGAACTTGAAGACAAGTCTCTTATGAATTA
ATTTAAGAAATTACAAAATATA GAAAGCTCTAACAATAGACTAAACCAAGCAGAAGAAAGAG TTCAGAACTTGAAGACAAGTCTCTTATGAATTAA
ATTTAAGAAATTACAAAATATAGTTGAA CTAACAATAGACTAAACCAAGCAGAAGAAAGAGTT CTTGAAGACAAGTCTCTTATGAATTAA
ATTTAAGAAATTACAAAATATAGTTGAAA CTAACAATAGACTAAACCAAGCAGAAGAAAGAGGTT TTGAAGACAAGTCTCTTATGAATTAA
ATTTAAGAAATTACAAAATATAGTTGAAAG TAACAATAGACTAAACCAAGCAGAAGAAAGAGGTT TGAAGACAAGTCTCTTATGAATTAA
ATTTAAGAAATTACAAAATATAGTTGAAAGCTCT ACAATAGACTAAACCAAGCAGAAGAAAGAGGTTCA TGAAGACAAGTCTCTTATGAATTAA
TTAAGAAATTACAAAATATAGTTGAAAGCTCTAAC GACTAAACCAAGCAGAAGAAAGAGGTTCAGAACTT AAGACAAGTCTCTTATGAATTAA
TAAGAAATTACAAAATATAGTTGAAAGCTCTAACAATAGA GGTTCAGAACTTGAAGACAAGTCTCTTATGAATTA
TTACAAAATATAGTTGAAAGCTCTAACAATAGACT GGTTCAGAACTTGAAGACAAGTCTCTTATGAATTA
ATAGTTGAAAGCTCTAACAATAGACTAAACCAAGC GTTCAGAACTTGAAGACAAGTCTCTTATGAATTAA
AAAGCTCTAACAATAGACTAAACCAAGCAGAAGAA TCAGAACTTGAAGACAAGTCTCTTATGAATTAA
AAAGCTCTAACAATAGACTAAACCAAGCAGAAGAA NAAGACAAGTCTCTTATGAATTAA
AAGCTCTAACAATAGACTAAACCAAGCAGAAGAAA GAAGACAAGTCTCTTATGAATTAA
TAACAATAGACTAAACCAAGCAGAAGAAAGAGGTT AGTCTCTTATGAATTAA
TAACAATAGACTAAACCAAGCAGAAGAAAGAGGTT GTCTCTTATGAATTAA
AACAATAGACTAAACCAAGCAGAAGAAAGAGGTTC
AACAATAGACTAAACCAAGCAGAAGAAAGAGGTTC
AATAGACTAAACCAAGCAGAAGAAAGAGGTTCAGA
AATAGACTAAACCAAGCAGAAGAAAGAGGTTCAGARemarks
The following figures visualize the relations between the different stores:


Member Functions Detail
void clearReads(store);
Parameters
store
|
The FragmentStore to remove all reads from. |
|---|
Clears the readStore, readSeqStore, and readNameStore.
Data Races
Interface Functions Detail
TSize appendAlignedRead(store, readId, contigId, beginPos, endPos[, pairMatchId]);
Parameters
store
|
The FragmentStore to append to. |
|---|---|
readId
|
The id of the read to append an alignment for. |
contigId
|
The id of the contig of the alignment. |
beginPos
|
The begin position of the alignment. |
endPos
|
The end position of the alignment. |
pairMatchId
|
The id of the alignedRead pair. Default: FragmentStore::INVALID_ID which corresponds to an unmated read. |
Returns
TSize |
The alignedReadId of the alignment. |
|---|
Remarks
This function appends a single read alignment to the alignedReadStore. Note that this really only adds a match. To generate a global alignment out of all these matches, use convertMatchesToGlobalAlignment.
Data Races
See Also
TSize appendMatePair(store, readSeq1, readSeq2[, name1, name2]);
Parameters
store
|
The FragmentStore to append the mate pair to. |
|---|---|
readSeq1
|
The read sequence of the first read. |
readSeq2
|
The read sequence of the second read. |
name1
|
The read name of the first read. |
name2
|
The read name of the first read. |
Returns
TSize |
The matePairId of the newly appended mate pair. TSize is the size type of the matePairStore. |
|---|
Remarks
This function appends two reads to the readStore and readSeqStore and a mate pair entry for both them to the matePairStore. If names are given, they are appended to readNameStore.
Data Races
TSize appendRead(store, read[, matePairId]);
TSize appendRead(store, read, name[, matePairId]);
Parameters
store
|
The FragmentStore to append the read to. |
|---|---|
read
|
The read sequence. Type: ContainerConcept. |
name
|
The name of the read. Type: CharString. |
matePairId
|
ID of the mate-pair that this read is part of. Default: FragmentStore::INVALID_ID which corresponds to an unmated read. |
Returns
TSize |
The readId of the newly appended read. TSize is the size type of the readStore. |
|---|
This funciton appends a single read to the readStore and readSeqStore.
Data Races
See Also
void calculateInsertSizes(insertSizes, store);
Parameters
insertSizes
|
A String of insert sizes. This string is accordingly resized and can be addressed by the pairMatchId. |
|---|---|
store
|
The FragmentStore to compute the insert sizes for. |
Remarks
This function calls compactPairMatchIds first and calcualte the insert size for every pair match. The insert size of a pair match is the outer distance between the two matches.
Data Races
void calculateMateIndices(mateIndices, store);
Parameters
mateIndices
|
A String with the resulting mate indices. This string is accordingly resized and can be addressed by the readId. |
|---|---|
store
|
The FragmentStore. |
Entries of reads without a mate contain INVALID_ID.
Data Races
void clearContigs(store);
Parameters
store
|
The FragmentStore to remove all contigs from. |
|---|
This function clears the contigStore and contigNameStore.
Data Races
TSize compactAlignedReads(store);
Parameters
store
|
The FragmentStore to compact the aligned reads of. |
|---|
Returns
s |
TSize The new size of the alignedReadStore. TSize is the size type of the alignedReadStore. |
|---|
Remarks
This function removes all entries from the alignedReadStore whose alignId is equal to INVALID_ID as well as orphan entries in alignQualityStore. Afterwards, the alignIds are renamed sequentially beginning with 0. This function can be used to remove alignments which are flagged by previously setting their id to INVALID_ID.
Data Races
TSize compactPairMatchIds(store);
Parameters
store
|
The FragmentStore to compact pair match ids of. |
|---|
Returns
TSize |
The number of pair matches. TSize is the size type of alignedReadStore. |
|---|
Remarks
This function renames the pairMatchId in the alignedReadStore sequentially beginning with 0. Two read alignments can be identified to be pair match if they have the same pairMatchId. Please note that paired reads not necessarily have to map as a pair match, e.g. if they are on different ocntigs or have the same orientation or a wrong insert size.
Data Races
void convertMatchesToGlobalAlignment(store, score, shrinkMatches);
Parameters
store
|
The fragment store. Types: FragmentStore |
|---|---|
score
|
A score object used by globalAlignment in this function. |
shrinkMatches
|
States whether the matches should be shrinked. Types: True, False |
Remarks
Before calling this function all gaps structures in alignedReadStore and contigStore must be empty, i.e. there are no gaps in the alignments. This function iterates over entries in the alignedReadStore and semi-global aligns each read to its contig segments given by begin and end position. Gaps introduced by these pair-wise alignments are then inserted to the affected contig and reads correspondingly.
The invariant that positions in the alignedReadStore are in gap-space holds before (there were no gaps in alignments) and after calling this functions.
If the alignQualityStore of the FragmentStore is empty when convertMatchesToGlobalAlignment() is called then the alignQualityStore is filled with the edit distance scores.
Data Races
void convertPairWiseToGlobalAlignment(store, pairwiseContigGaps);
Parameters
store
|
The fragment store. Types: FragmentStore |
|---|---|
pairwiseContigGaps
|
A String of anchored contig gaps for every pairwise alignment. |
Remarks
Before calling this function the gaps structures in the contigStore must be empty, i.e. there are no gaps in the contig. The pairwise alignment gaps of the reads are stored in the gaps structure in the alignedReadStore, whereas the pairwise alignment gaps of the contig are stored in the pairwiseContigGaps string.
After calling this functions all positions in the alignedReadStore are in gap-space.
Data Races
void getClrRange(store, alignEl, begClr, endClr);
Parameters
store
|
The FragmentStore to work on. |
|---|---|
alignEl
|
The AlignedReadStoreElement to work on. |
begClr
|
Begin of the clear range. |
endClr
|
End of the clear range. |
The clear range of a read alignment is the range of the part of the alignmetn that is not clipped.
Data Races
int getMateNo(store, readId);
Parameters
store
|
The FragmentStore with the read. |
|---|---|
readId
|
The readId. |
Returns
int |
The mate number (0 for the first mate, 1 for the second mate) of the read in its mate pair or -1 if the read is not paired. |
|---|
Data Races
TRead getRead(store, id);
Parameters
store
|
The FragmentStore to query for the read. |
|---|---|
id
|
The id of the read. |
Returns
TRead |
The entry from the readStore. TRead is the value type of the readStore. |
|---|
Data Races
bool loadContig(store, contigId);
Parameters
store
|
The FragmentStore to load the contig for. |
|---|---|
contigId
|
The id of the contig that was created earlier by loadContigs. |
Returns
bool |
true on success, false on failure. |
|---|
Data Races
bool loadContigs(store, fileName[, loadSeqs]);
bool loadContigs(store, fileNameList[, loadSeqs]);
Parameters
store
|
The FragmentStore to append the contigs to. |
|---|---|
fileName
|
A CharString with the name of the file to load. |
fileNameList
|
A StringSet of CharString with a list of file names to load. |
loadSeqs
|
A bool indicating whether to load lazily. If true then sequences are loaded immediately. If false, an emptycontig with a reference to the file is created. Its sequence can be loaded on demand by lockContig and loadContig. |
Returns
bool |
true in case of success and false in case of error. |
|---|
Data Races
bool loadReads(store, fileName);
bool loadReads(store, fileNameL, fileNameR);
Parameters
store
|
The FragmentStore to append the reads to. |
|---|---|
fileName
|
Path to single-end read file. |
fileNameL
|
Path to left read file in case of paired reads. |
fileNameR
|
Path to right read file in case of paired reads. |
Returns
bool |
true in case of success, false in case of errors. |
|---|
When two file names are given thent he files are expected to containt he same number of reads and reads with the same index are assumed to be mate pairs. Mate pairs are stored internally in an "interleaved mode": a read is read from each file before reading the next one.
Data Races
bool lockContig(store, contigId);
Parameters
store
|
The FragmentStore to lock the contig for. |
|---|---|
contigId
|
The id of the contig that was created earlier by loadContigs. |
Returns
bool |
true on success, false on failure. |
|---|
This function increases the contig usage counter by 1 and ensures that the contig sequence is loaded.
Data Races
bool lockContigs(store);
Parameters
store
|
The FragmentStore to lock the contigs for. |
|---|
Returns
bool |
true in case of success, false in case of errors. |
|---|
Data Races
int read(file, store, tag);
Parameters
file
|
The StreamConcept to read from. |
|---|---|
store
|
The FragmentStore to append to. |
tag
|
The format to read from. Can be Amos or Sam. |
Returns
int |
0 in the case of success, non-0 value in case of errors. |
|---|
Data Races
void readRecords(store, bamFileIn[, importFlags]);
void readRecords(store, gffFileIn);
void readRecords(store, ucscFileIn);
Parameters
store
|
The FragmentStore object to store the records into. |
|---|---|
bamFileIn
|
The BamFileIn object to read from. |
gffFileIn
|
The GffFileIn object to read from. |
ucscFileIn
|
The UcscFileIn object to read from. |
importFlags
|
The import flags. |
Thrown Exceptions
IOError |
On low-level I/O errors. |
|---|---|
ParseError |
On high-level file format errors. |
Data Races
bool unlockContig(store, contigId);
Parameters
store
|
The FragmentStore to unlock the contig for. |
|---|---|
contigId
|
The id of the contig that was created earlier by loadContigs. |
Returns
bool |
true on success, false on failure. |
|---|
This function decreases the contig usage counter by 1 and frees the sequences' memory if the counter equals 0.
Data Races
bool unlockAndFreeContigs(store);
Parameters
store
|
The FragmentStore to unlock the contigs for. |
|---|
Returns
bool |
true in case of success, false in case of errors. |
|---|
Data Races
bool unlockContig(store, contigId);
Parameters
store
|
The FragmentStore to unlock the contig for. |
|---|---|
contigId
|
The id of the contig that was created earlier by loadContigs. |
Returns
bool |
true on success, false on failure. |
|---|
This function decreases the contig usage counter by 1.
Data Races
bool unlockContigs(store);
Parameters
store
|
The FragmentStore to unlock the contigs for. |
|---|
Returns
bool |
true in case of success, false in case of errors. |
|---|
Data Races
int write(file, store, tag);
Parameters
file
|
The StreamConcept to write to. |
|---|---|
store
|
The FragmentStore to write to the file. |
tag
|
The format to write out. Types: Sam or Amos. |
Returns
int |
0 in case of success, 1 in case of errors. |
|---|
Data Races
bool writeContigs(file, store, tag);
Parameters
file
|
The StreamConcept to write to. |
|---|---|
store
|
The FragmentStore to write contigs of. |
tag
|
A tag for the sequence format. |
Returns
bool |
true on success, false on errors. |
|---|
Data Races
void writeRecords(bamFileOut, store);
void writeRecords(gffFileOut, store);
void writeRecords(ucscFileIn, store);
Parameters
bamFileOut
|
The BamFileOut object to write into. |
|---|---|
gffFileOut
|
The GffFileOut object to write into. |
ucscFileOut
|
The UcscFileOut object to write into. |
store
|
The FragmentStore object. |
Thrown Exceptions
IOError |
On low-level I/O errors. |
|---|
Data Races
Member Typedef Detail
typedef (..) TFragmentStore::TAlignedReadStore;
typedef (..) TFragmentStore::TAlignedReadTagStore;
typedef (..) TFragmentStore::TAlignQualityStore;
typedef (..) TFragmentStore::TAnnotationKeyStore;
typedef (..) TFragmentStore::TAnnotationNameStore;
typedef (..) TFragmentStore::TAnnotationStore;
typedef (..) TFragmentStore::TAnnotationTypeStore;
typedef (..) TFragmentStore::TContigFileStore;
typedef (..) TFragmentStore::TContigNameStore;
typedef (..) TFragmentStore::TContigStore;
typedef (..) TFragmentStore::TLibraryNameStore;
typedef (..) TFragmentStore::TMatePairNameStore;
typedef (..) TFragmentStore::TMatePairStore;
typedef (..) TFragmentStore::TReadNameStore;
typedef (..) TFragmentStore::TReadSeqStore;
typedef (..) TFragmentStore::TReadStore;
Member Variables Detail
FragmentStore::TAlignedReadStore FragmentStore::alignedReadStore
The value type is AlignedReadStoreElement.
Remarks
You can sort alignedReadStore using sortAlignedReads. After sorting, you can use the functions lowerBoundAlignedReads and upperBoundAlignedReads to perform a binary search, e.g. for accessing only a subrange.
FragmentStore::TAlignedReadTagStore FragmentStore::alignedReadTagStore
FragmentStore::TAlignQualityStore FragmentStore::alignQualityStore
The value type is AlignQualityStoreElement.
FragmentStore::TAnnotationKeyStore FragmentStore::annotationKeyStore
FragmentStore::TAnnotationNameStore FragmentStore::annotationNameStore
FragmentStore::TAnnotationStore FragmentStore::annotationStore
The value type is AnnotationStoreElement.
Instead of accessing this store directly, consider to use the high-level interface provided by AnnotationTreeIterator.
FragmentStore::TAnnotationTypeStore FragmentStore::annotationTypeStore
Remarks
There are predefined type ids for commonly used types e.g. ANNO_GENE or ANNO_EXON which can be used to set the typeId directly as a fast alternative to getType and setType.
FragmentStore::TContigFileStore FragmentStore::contigFileStore
Value type is ContigFile.
FragmentStore::TContigNameStore FragmentStore::contigNameStore
FragmentStore::TContigStore FragmentStore::contigStore
Value type is ContigStoreElement.
FragmentStore::TLibraryNameStore FragmentStore::libraryNameStore
FragmentStore::TLibraryStore FragmentStore::libraryStore
Value type is LibraryStoreElement.
FragmentStore::TContigNameStore FragmentStore::matePairNameStore
FragmentStore::TMatePairStore FragmentStore::matePairStore
The value type is MatePairStoreElement.
FragmentStore::TReadNameStore FragmentStore::readNameStore
FragmentStore::TReadSeqStore FragmentStore::readSeqStore
FragmentStore::TReadStore FragmentStore::readStore
The value type is ReadStoreElement.